Show simple item record

dc.creatorZhu, Yuanjun
dc.creatorSaribas, A. Sami
dc.creatorLiu, Jinbiao
dc.creatorLin, Yuan
dc.creatorBodnar, Brittany
dc.creatorZhao, Ruotong
dc.creatorGuo, Qian
dc.creatorTing, Julia
dc.creatorWei, Zhengyu
dc.creatorEllis, Aidan
dc.creatorLi, Fang
dc.creatorWang, Xu
dc.creatorYang, Xiaofeng
dc.creatorWang, Hong
dc.creatorHo, Wen-Zhe
dc.creatorYing, Ling
dc.creatorHu, Wenhui
dc.date.accessioned2023-09-13T16:51:22Z
dc.date.available2023-09-13T16:51:22Z
dc.date.issued2023-04-05
dc.identifier.citationYuanjun Zhu, A. Sami Saribas, Jinbiao Liu, Yuan Lin, Brittany Bodnar, Ruotong Zhao, Qian Guo, Julia Ting, Zhengyu Wei, Aidan Ellis, Fang Li, Xu Wang, Xiaofeng Yang, Hong Wang, Wen-Zhe Ho, Ling Yang, Wenhui Hu, Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization, Molecular Therapy, Volume 31, Issue 4, 2023, Pages 1136-1158, ISSN 1525-0016, https://doi.org/10.1016/j.ymthe.2023.02.012. (https://www.sciencedirect.com/science/article/pii/S1525001623000758)
dc.identifier.issn1525-0024
dc.identifier.urihttp://hdl.handle.net/20.500.12613/9038
dc.description.abstractBoosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
dc.format.extent23 pages
dc.languageEnglish
dc.language.isoeng
dc.relation.ispartofOpen Access Publishing Fund
dc.relation.haspartMolecular Therapy, Vol. 31, Iss. 4
dc.relation.isreferencedbyCell Press
dc.rightsAttribution CC BY
dc.rights.urihttps://creativecommons.org/licenses/by/4.0/
dc.subjectOligonucleotide motif
dc.subjectCis-regulation
dc.subjectProtein expression
dc.subjectProtein secretion
dc.subjectmRNA
dc.subjectVaccine
dc.subjectAntibody
dc.subjectSARS-CoV-2
dc.titleProtein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization
dc.typeText
dc.type.genreJournal article
dc.contributor.groupCenter for Metabolic Disease Research (Temple University)
dc.description.departmentPathology and Laboratory Medicine
dc.description.departmentMedical Genetics & Molecular Biochemistry
dc.relation.doihttps://doi.org/10.1016/j.ymthe.2023.02.012
dc.ada.noteFor Americans with Disabilities Act (ADA) accommodation, including help with reading this content, please contact scholarshare@temple.edu
dc.description.schoolcollegeLewis Katz School of Medicine
dc.description.sponsorTemple University Libraries Open Access Publishing Fund, 2022-2023 (Philadelphia, Pa.)
dc.creator.orcidBodnar|0000-0003-0467-5219
dc.creator.orcidYang|0000-0002-6854-6195
dc.creator.orcidWang|0000-0001-6258-4070
dc.temple.creatorZhu, Yuanjun
dc.temple.creatorSaribas, A. Sami
dc.temple.creatorLiu, Jinbiao
dc.temple.creatorLin, Yuan
dc.temple.creatorBodnar, Brittany
dc.temple.creatorZhao, Ruotong
dc.temple.creatorGuo, Qian
dc.temple.creatorTing, Julia
dc.temple.creatorWei, Zhengyu
dc.temple.creatorEllis, Aidan
dc.temple.creatorLi, Fang
dc.temple.creatorWang, Xu
dc.temple.creatorYang, Xiaofeng
dc.temple.creatorWang, Hong
dc.temple.creatorHo, Wen-Zhe
dc.temple.creatorYing, Ling
dc.temple.creatorHu, Wenhui
refterms.dateFOA2023-09-13T16:51:22Z


Files in this item

Thumbnail
Name:
ZhuEtAl-JournalArticle-2023-04.pdf
Size:
5.574Mb
Format:
PDF

This item appears in the following Collection(s)

Show simple item record

Attribution CC BY
Except where otherwise noted, this item's license is described as Attribution CC BY