RSS 1.0Faculty/ Researcher Works
ABOUT THE COLLECTION
The Faculty/ Researcher Works collection focuses on research, scholarship, and creative works, as well as materials that primarily reflect the intellectual environment of the Temple University campus.
Sub-communities within this community
Collections in this community
Recent Submissions
-
Environmental Co-Benefits of Maintaining Native Vegetation With Solar Photovoltaic InfrastructureCo-locating solar photovoltaics with vegetation could provide a sustainable solution to meeting growing food and energy demands. However, studies quantifying multiple co-benefits resulting from maintaining vegetation at utility-scale solar power plants are limited. We monitored the microclimate, soil moisture, panel temperature, electricity generation and soil properties at a utility-scale solar facility in a continental climate with different site management practices. The compounding effect of photovoltaic arrays and vegetation may homogenize soil moisture distribution and provide greater soil temperature buffer against extreme temperatures. The vegetated solar areas had significantly higher soil moisture, carbon, and other nutrients compared to bare solar areas. Agrivoltaics in agricultural areas with carbon debt can be an effective climate mitigation strategy along with revitalizing agricultural soils, generating income streams from fallow land, and providing pollinator habitats. However, the benefits of vegetation cooling effects on electricity generation are rather site-specific and depend on the background climate and soil properties. Overall, our findings provide foundational data for site preservation along with targeting site-specific co-benefits, and for developing climate resilient and resource conserving agrivoltaic systems.
-
Urban neighbourhood elements that influence psychoactive substance use among populations with adverse childhood experiences: a scoping review protocolIntroduction: Adverse childhood experiences (ACEs) are stressful or traumatic events experienced before the age of 18 years old. ACEs have been associated with an increased risk for substance use in adulthood. While an abundance of research has examined psychosocial factors that explain the link between ACEs and psychoactive substance use, little is known about the additional influence of the urban neighbourhood environment, including community-level factors, that influence the risk of substance use among populations with a history of ACEs. Methods and analysis: The following databases will be systematically searched: PubMed, Embase, Web of Science, Cochrane, PsycInfo, CINAHL, Clinicaltrials.gov and TRIP medical databases. After the title and abstract screening and full-text screening, we will also conduct a manual search of the reference sections of included articles and include relevant citations. Eligibility criteria include peer-reviewed articles that focus on populations with at least one ACE, factors from the urban neighbourhood community, such as elements from the built environment, presence of community service programmes, quality and vacancy of housing, neighbourhood level social cohesion, and neighbourhood level collective efficacy or crime. Included articles should also include terms such as ‘substance abuse’, ‘prescription misuse’ and ‘dependence’. Only studies written or translated into the English language will be included. Ethics and dissemination: This systematic and scoping review will focus on peer-reviewed publications and does not require ethics approval. Findings will be available for clinicians, researchers and community members via publications and social media. This protocol describes the rationale and methods for the first scoping review to inform future research and community-level intervention development that targets substance use among populations who have experienced ACEs.
-
Comparison of urine heavy metals in exclusive menthol and non-menthol cigarette users by race/ethnicity: The 2015–2016 National Health and Nutrition Examination Survey Special SampleIntroduction: The objective of this study was to investigate the differences in urine concentrations of heavy metals (uranium, cadmium, and lead) between exclusive menthol and non-menthol cigarette smokers across three racial/ethnic groups using data from the National Health and Nutrition Examination Survey (NHANES) 2015– 2016 Special Sample. Methods: Data from NHANES 2015–2016 Special Sample were analyzed to assess the association between menthol smoking and heavy metal biomarkers in urine across three racial/ethnic groups (N=351), including Non-Hispanic White (NHW), Non-Hispanic Black (NHB), and Hispanic/Other (HISPO). Multivariable linear regression models were used to estimate adjusted geometric means (GMs) and ratio of GMs (menthol/non-menthol smokers) (RGMs) for urine biomarkers of heavy metals between menthol and non-menthol smokers by race/ethnicity. Results: Among the 351 eligible participants, 34.4% (n=121) were NHW, 33.6% (n=118) were NHB, and 32.0% (n=112) were HISPO exclusive cigarette smokers. The analysis revealed significantly higher concentrations of urine uranium in NHB menthol smokers compared to NHB non-menthol smokers (RGMs=1.3; 95% CI: 1.0–1.6; p=0.04). NHW menthol smokers appeared to have higher levels of urine uranium than non-menthol smokers, but the difference was not statistically significant (9.0 vs 6.3; RGMs=1.4; 95% CI: 1.0–2.2; p=0.08). There were no significant differences in urine metals (cadmium and lead) by menthol status among NHW, NHB, or HISPO cigarette smokers (p>0.05). Conclusions: The research findings regarding the higher levels of urine uranium among Non-Hispanic Black (NHB) menthol cigarette smokers raise questions about the claims suggesting that additives in cigarettes do not contribute to increased toxicity.
-
Reward and Immune Systems in Emotion (RISE) prospective longitudinal study: Protocol overview of an integrative reward-inflammation model of first onset of major depression in adolescenceBackground: Depression is associated with a reduced sensitivity to rewards and low reward-related brain function in cortico-striatal circuitry. A separate literature documents elevated peripheral inflammation in depression. Recently, integrated reward-inflammation models of depression have been proposed. These models draw on work indicating that peripheral inflammatory proteins access the brain, where they lower reward responsiveness. This blunted reward responsiveness is proposed to initiate unhealthy behaviors (substance use, poor diet), as well as sleep disruption and stress generation, which further heighten inflammation. Over time, dysregulation in reward responsiveness and immune signaling may synergize in a positive feedback loop, whereby dysregulation in each system exacerbates dysregulation in the other. Project RISE (Reward and Immune Systems in Emotion) provides a first systematic test of reward-immune dysregulation as a synergistic and dynamic vulnerability for first onset of major depressive disorder and increases in depressive symptoms during adolescence. Methods: This NIMH-funded R01 study is a 3-year prospective, longitudinal investigation of approximately 300 community adolescents from the broader Philadelphia area, United States of America. Eligible participants must be 13–16 years old, fluent in English, and without a prior major depressive disorder. They are being selected along the entire dimension of self-reported reward responsiveness, with oversampling at the low tail of the dimension in order to increase the likelihood of major depression onsets. At Time 1 (T1), T3, and T5, each a year apart, participants complete blood draws to quantify biomarkers of low-grade inflammation, self-report and behavioral measures of reward responsiveness, and fMRI scans of reward neural activity and functional connectivity. At T1-T5 (with T2 and T4 six months between the yearly sessions), participants also complete diagnostic interviews and measures of depressive symptoms, reward-relevant life events, and behaviors that increase inflammation. Adversity history is assessed at T1 only. Discussion: This study is an innovative integration of research on multi-organ systems involved in reward and inflammatory signaling in understanding first onset of major depression in adolescence. It has the potential to facilitate novel neuroimmune and behavioral interventions to treat, and ideally prevent, depression.
-
Tensorial independent component analysis reveals social and reward networks associated with major depressive disorderMajor depressive disorder (MDD) has been associated with changes in functional brain connectivity. Yet, typical analyses of functional connectivity, such as spatial independent components analysis (ICA) for resting-state data, often ignore sources of between-subject variability, which may be crucial for identifying functional connectivity patterns associated with MDD. Typically, methods like spatial ICA will identify a single component to represent a network like the default mode network (DMN), even if groups within the data show differential DMN coactivation. To address this gap, this project applies a tensorial extension of ICA (tensorial ICA)—which explicitly incorporates between-subject variability—to identify functionally connected networks using functional MRI data from the Human Connectome Project (HCP). Data from the HCP included individuals with a diagnosis of MDD, a family history of MDD, and healthy controls performing a gambling and social cognition task. Based on evidence associating MDD with blunted neural activation to rewards and social stimuli, we predicted that tensorial ICA would identify networks associated with reduced spatiotemporal coherence and blunted social and reward-based network activity in MDD. Across both tasks, tensorial ICA identified three networks showing decreased coherence in MDD. All three networks included ventromedial prefrontal cortex, striatum, and cerebellum and showed different activation across the conditions of their respective tasks. However, MDD was only associated with differences in task-based activation in one network from the social task. Additionally, these results suggest that tensorial ICA could be a valuable tool for understanding clinical differences in relation to network activation and connectivity.
-
Anti-Ballistic Performance of PPTA/UHMWPE LaminatesPoly(p-phenylene terephthalamide) (PPTA) and ultra-high-molecular-weight polyethylene (UHMWPE) are high-performance polymer materials largely used for body armor applications. Although composite structures from a combination of PPTA and UHMWPE have been created and described in the literature, the manufacture of layered composites from PPTA fabrics and UHMWPE films with UHMWPE film as an adhesive layer has not been reported. Such a new design can provide the obvious advantage of simple manufacturing technology. In this study, for the first time, we prepared PPTA fabrics/UHMWPE films laminate panels using plasma treatment and hot-pressing and examined their ballistic performance. Ballistic testing results indicated that samples with moderate interlayer adhesion between PPTA and UHMWPE layers exhibited enhanced performance. A further increase in interlayer adhesion showed a reverse effect. This finding implies that optimization of interface adhesion is essential to achieve maximum impact energy absorption through the delamination process. In addition, it was found that the stacking sequence of the PPTA and UHMWPE layers affected ballistic performance. Samples with PPTA as the outermost layer performed better than those with UHMWPE as the outermost layer. Furthermore, microscopy of the tested laminate samples showed that PPTA fibers exhibited shear cutting failure on the entrance side and tensile failure on the exit side of the panel. UHMWPE films exhibited brittle failure and thermal damage at high compression strain rate on the entrance side and tensile fracture on the exit side. For the first time, findings from this study reported in-field bullet testing results of PPTA/UHMWPE composite panels, which can provide important insights for designing, fabricating, and failure analysis of such composite structures for body armors.
-
Interrelationships of Sleep Quality, Obesity Severity, and Clinical Headache Features among Women with Comorbid Migraine and ObesityObesity and migraine are often comorbid. Poor sleep quality is also common among individuals with migraine and may be influenced by comorbidities such as obesity. However, understanding of migraine’s relationship with sleep and the potential exacerbating effect of obesity remains limited. This study evaluated the associations of migraine characteristics and clinical features with sleep quality among women with comorbid migraine and overweight/obesity and assessed the interplay between obesity severity and migraine characteristics/clinical features in relation to sleep quality. Women seeking treatment for migraine and obesity (n = 127; NCT01197196) completed a validated questionnaire assessing sleep quality (Pittsburgh Sleep Quality Index-PSQI). Migraine headache characteristics and clinical features were assessed using smartphone-based daily diaries. Weight was measured in-clinic, and several potential confounders were assessed using rigorous methods. Nearly 70% of participants endorsed poor sleep quality. Greater monthly migraine days and the presence of phonophobia related to poorer sleep quality, and specifically poorer sleep efficiency, controlling for confounders. Obesity severity was neither independently associated nor interacted with migraine characteristics/features to predict sleep quality. Poor sleep quality is common among women with comorbid migraine and overweight/obesity, although obesity severity does not appear to uniquely relate to or exacerbate the association between migraine and sleep in this population. Results can guide research on mechanisms of the migraine–sleep link and inform clinical care.
-
Bootstrap confidence for molecular evolutionary estimates from tumor bulk sequencing dataBulk sequencing is commonly used to characterize the genetic diversity of cancer cell populations in tumors and the evolutionary relationships of cancer clones. However, bulk sequencing produces aggregate information on nucleotide variants and their sample frequencies, necessitating computational methods to predict distinct clone sequences and their frequencies within a sample. Interestingly, no methods are available to measure the statistical confidence in the variants assigned to inferred clones. We introduce a bootstrap resampling approach that combines clone prediction and statistical confidence calculation for every variant assignment. Analysis of computer-simulated datasets showed the bootstrap approach to work well in assessing the reliability of predicted clones as well downstream inferences using the predicted clones (e.g., mapping metastatic migration paths). We found that only a fraction of inferences have good bootstrap support, which means that many inferences are tentative for real data. Using the bootstrap approach, we analyzed empirical datasets from metastatic cancers and placed bootstrap confidence on the estimated number of mutations involved in cell migration events. We found that the numbers of driver mutations involved in metastatic cell migration events sourced from primary tumors are similar to those where metastatic tumors are the source of new metastases. So, mutations with driver potential seem to keep arising during metastasis. The bootstrap approach developed in this study is implemented in software available at https://github.com/SayakaMiura/CloneFinderPlus.
-
Extensive set of African ancestry-informative markers (AIMs) to study ancestry and population healthIntroduction: Human populations are often highly structured due to differences in genetic ancestry among groups, posing difficulties in associating genes with diseases. Ancestry-informative markers (AIMs) aid in the detection of population stratification and provide an alternative approach to map population-specific alleles to disease. Here, we identify and characterize a novel set of African AIMs that separate populations of African ancestry from other global populations including those of European ancestry. Methods: Using data from the 1000 Genomes Project, highly informative SNP markers from five African subpopulations were selected based on estimates of informativeness (In) and compared against the European population to generate a final set of 46,737 African ancestry-informative markers (AIMs). The AIMs identified were validated using an independent set and functionally annotated using tools like SIFT, PolyPhen. They were also investigated for representation of commonly used SNP arrays. Results: This set of African AIMs effectively separates populations of African ancestry from other global populations and further identifies substructure between populations of African ancestry. When a subset of these AIMs was studied in an independent dataset, they differentiated people who self-identify as African American or Black from those who identify their ancestry as primarily European. Most of the AIMs were found to be in their intergenic and intronic regions with only 0.6% in the coding regions of the genome. Most of the commonly used SNP array investigated contained less than 10% of the AIMs. Discussion: While several functional annotations of both coding and non-coding African AIMs are supported by the literature and linked these high-frequency African alleles to diseases in African populations, more effort is needed to map genes to diseases in these genetically diverse subpopulations. The relative dearth of these African AIMs on current genotyping platforms (the array with the highest fraction, llumina’s Omni 5, harbors less than a quarter of AIMs), further demonstrates a greater need to better represent historically understudied populations.
-
Adrenal Crisis as An Adverse Reaction to Zoledronic Acid in a Patient With Primary Adrenal Insufficiency: A Case Report and Literature ReviewBackground/Objective: Adrenal crisis is a medical emergency and an acute complication of adrenal insufficiency (AI). It can be triggered by stressors such as infection, dehydration, trauma, or surgery. Case Report: We present a case of a 70-year-old woman with a history of Addison’s disease, who presented in adrenal crisis within 24 hours after receiving her first infusion of zoledronic acid. No trigger was identified after extensive evaluation, making infusion with zoledronic acid the most likely cause of adrenal crisis. Discussion: Adverse reactions to medications can potentially trigger adrenal crisis. The present case report demonstrates that intravenous bisphosphonates can cause an acute phase reaction that may lead to adrenal crisis. Given the increased risk of osteoporosis in patients with AI there is an increased likelihood of prescription of intravenous bisphosphonates in this patient population. Conclusion: Patients with AI undergoing infusion with zoledronic acid may require an increased dose of glucocorticoid prior to infusion and may need to undergo monitoring post infusion for possible adrenal crisis.
-
Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilizationBoosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
-
Characterizing heterogeneity in early adolescent reward networks and individualized associations with behavioral and clinical outcomesAssociations between connectivity networks and behavioral outcomes such as depression are typically examined by comparing average networks between known groups. However, neural heterogeneity within groups may limit the ability to make inferences at the individual level as qualitatively distinct processes across individuals may be obscured in group averages. This study characterizes the heterogeneity of effective connectivity reward networks among 103 early adolescents and examines associations between individualized features and multiple behavioral and clinical outcomes. To characterize network heterogeneity, we used extended unified structural equation modeling to identify effective connectivity networks for each individual and an aggregate network. We found that an aggregate reward network was a poor representation of individuals, with most individual-level networks sharing less than 50% of the group-level network paths. We then used Group Iterative Multiple Model Estimation to identify a group-level network, subgroups of individuals with similar networks, and individual-level networks. We identified three subgroups that appear to reflect differences in network maturity, but this solution had modest validity. Finally, we found numerous associations between individual-specific connectivity features and behavioral reward functioning and risk for substance use disorders. We suggest that accounting for heterogeneity is necessary to use connectivity networks for inferences precise to the individual.
-
Clinical outcomes and factors associated with pulmonary infarction following acute pulmonary embolism: a retrospective observational study at a US academic centreObjective: Pulmonary infarction is a common clinical and radiographic finding in acute pulmonary embolism (PE), yet the clinical relevance and prognostic significance of pulmonary infarction remain unclear. The study aims to investigate the clinical features, radiographic characteristics, impact of reperfusion therapy and outcomes of patients with pulmonary infarction. Design, setting and participants: A retrospective cohort study of 496 adult patients (≥18 years of age) diagnosed with PE who were evaluated by the PE response team at a tertiary academic referral centre in the USA. We collected baseline characteristics, laboratory, radiographic and outcome data. Statistical analysis was performed by Student’s t-test, Mann-Whitney U test, Fischer’s exact or χ2 test where appropriate. Multivariate logistic regression was used to evaluate potential risk factors for pulmonary infarction. Results: We identified 143 (29%) cases of pulmonary infarction in 496 patients with PE. Patients with infarction were significantly younger (52±15.9 vs 61±16.6 years, p<0.001) and with fewer comorbidities. Most infarctions occurred in the lower lobes (60%) and involved a single lobe (64%). The presence of right ventricular (RV) strain on CT imaging was significantly more common in patients with infarction (21% vs 14%, p=0.031). There was no significant difference in advanced reperfusion therapy, in-hospital mortality, length of stay and readmissions between groups. In multivariate analysis, age and evidence of RV strain on CT and haemoptysis increased the risk of infarction. Conclusions: Radiographic evidence of pulmonary infarction was demonstrated in nearly one-third of patients with acute PE. There was no difference in the rate of reperfusion therapies and the presence of infarction did not correlate with poorer outcomes.
-
Insights from the management of offshore energy resources: Toward an ecosystem-services based management approach for deep-ocean industriesThe deep ocean comprises complex ecosystems made up of numerous community and habitat types that provide multiple services that benefit humans. As the industrialization of the deep sea proceeds, a standardized and robust set of methods and metrics need to be developed to monitor the baseline conditions and any anthropogenic and climate change-related impacts on biodiversity, ecosystem function, and ecosystem services. Here, we review what we have learned from studies involving offshore-energy industries, including state-of-the-art technologies and strategies for obtaining reliable metrics of deep-sea biodiversity and ecosystem function. An approach that includes the detection and monitoring of ecosystem services, with open access to baseline data from multiple sectors, can help to improve our global capacity for the management of the deep ocean.
-
Prolonged mask wearing does not alter the oral microbiome, salivary flow rate or gingival health status – A pilot studyThe COVID-19 pandemic has resulted in the widespread use of N95 respirators and surgical masks, with anecdotal reports among healthcare providers and the public of xerostomia, halitosis, and gingivitis, a consortium of symptoms colloquially termed “mask mouth”. However, this has not been scientifically verified. The aim of this study was to assess changes in salivary flow rate, gingival health status and oral microbiome associated with prolonged mask use. A total of 25 dental students (mean age = 26.36 ± 1.58) were included in the study and evaluated at three time points: T1, at the end of at least 2 months of full-day mask wear (7.26 ± 1.56 hours/day); T2, at the end of a period of minimal mask use (1.13 ± 1.13 hours/day); and T3, at the end of 2-3 weeks of resuming full-day mask wear (6.93 ± 1.80 hours/day). Unstimulated whole saliva (UWS) flow rate, xerostomia (on a quantitative scale of 10), gingival index (GI) and plaque index (PI) were assessed at each time point. The salivary microbiome was characterized using 16S rRNA gene sequencing. Overall, UWS flow rates were normal (mean of 0.679 ml/min) and xerostomia, PI and GI scores were low (Mean of 3.11, 0.33 and 0.69, respectively) with no significant differences as a result of prolonged mask wearing. Similarly, there were no significant microbial changes at a false discovery rate (FDR) ≤ 0.05. However, some trends were identified using a nominal p-value cut-off of ≤ 0.01, namely Gemella sanguinis, Streptococcus sp. Oral taxon 066 and Oral taxon 058 were associated with prolonged mask wear. Trends were also seen by gender, race and age, for example an increase in P. gingivalis and P. intermedia with age. In conclusion, we found no evidence that prolonged mask wear adversely affects oral health. The findings support that the oral microbiome of healthy individuals is resilient.
-
Racial Disparity in Gender Affirming Surgery: A Comparative Study on Plastic Surgeon Social Media UseBackground: In the past 5 years, social media use among plastic surgeons has grown to become a common modality used to promote one’s practice. However, surgeons lack the necessary ethical training to understand how their published content impacts patient opinions and behavior. Social media trends among plastic surgeons may contribute to the reduced rate of Black (non-White) patients accessing gender affirming surgery. Methods: In total, 250 gender affirming surgeons and 51,698 individual posts from social media platform, Instagram, were manually extracted and analyzed. Posts were assessed for inclusion and categorized by the subject’s skin color (White versus non-White) using the Fitzpatrick scale. Results: Of the 3101 included posts, 375 (12.1%) portrayed non-White subjects. Of the 56 included surgeons, White surgeons were found to be 2.3 times less likely to include non-White subjects in their posts, compared with non-White surgeons. Regionally, surgeons practicing in the Northeast had the most racially diverse social media accounts, with over 20% of all posts including a non-White subject. Analyzing data over the past 5 years demonstrated no relative increase in the amount of non-White subjects being displayed on social media, while social media use by gender affirming surgeons had increased by over 200%. Conclusions: The low number of non-White individuals portrayed by surgeons on social media perpetuates the racial disparity seen in patients accessing gender affirming surgery. Surgeons must be conscious of the demographic they portray on social media, as a lack of representation may influence patients’ self-identify and decision to utilize gender affirming surgical treatment.
-
Social Media Use Among Hand SurgeonsBackground: Recently social media use within healthcare has increased significantly. Today, it is common for patients to browse the Internet, including physicians’ social media pages, to learn about their medical conditions and search for providers. The purpose of this study is to analyze the use of social media among hand surgeons, and to compare this use between academic and private surgeons. Methods: Using the American Society for Surgery of the Hand’s (ASSH) online directory, all active members practicing within the ten most populated U.S. cities were identified. Social media presence was determined by an Internet search of platforms. Members were stratified by practice model (academic vs. private). Chi-square and t-tests were used to compare categorical and continuous variables, and a multivariable logistic regression was performed for the binary variable practice model. Results: Two hundred and fifty-six hand surgeons were identified with 150 (59%) in academic and 106 (41%) in private practice. For ResearchGate accounts, 51 (82%) were academic and 11 (18%) were private. Mean PubMed publications was 38 for academic and 9 for private. YouTube presence was 69 (70%) in academic and 29 (30%) in private. On multivariable analysis, the odds of having ResearchGate and YouTube presence were higher for academic practice. There was no statistically significant difference by practice type for Facebook, Twitter, LinkedIn, and Instagram. Conclusions: With the recent social media expansion, surgeons have adopted social media platforms to reach patients. While the literature has shown that private practices are more active in social media, our results show they are not more active than academic practices in the ten most populated U.S. cities. Level of Evidence: IV
-
Enhancing the Psychometric Properties of the Iowa Gambling Task Using Full Generative ModelingPoor psychometrics, particularly low test-retest reliability, pose a major challenge for using behavioral tasks in individual differences research. Here, we demonstrate that full generative modeling of the Iowa Gambling Task (IGT) substantially improves test-retest reliability and may also enhance the IGT’s validity for use in characterizing internalizing pathology, compared to the traditional analytic approach. IGT data (n =50) was collected across two sessions, one month apart. Our full generative model incorporated (1) the Outcome Representation Learning (ORL) computational model at the person-level and (2) a group-level model that explicitly modeled test-retest reliability, along with other group-level effects. Compared to the traditional ‘summary score’ (proportion good decks selected), the ORL model provides a theoretically rich set of performance metrics (Reward Learning Rate (A+), Punishment Learning Rate (A-), Win Frequency Sensitivity (βf), Perseveration Tendency (βp), Memory Decay (K)), capturing distinct psychological processes. While test-retest reliability for the traditional summary score was only moderate (r = .37, BCa 95% CI [.04, .63]), test-retest reliabilities for ORL performance metrics produced by the full generative model were substantially improved, with test-retest correlations ranging between r = .64–.82. Further, while summary scores showed no substantial associations with internalizing symptoms, ORL parameters were significantly associated with internalizing symptoms. Specifically, Punishment Learning Rate was associated with higher self-reported depression and Perseveration Tendency was associated with lower self-reported anhedonia. Generative modeling offers promise for advancing individual differences research using the IGT, and behavioral tasks more generally, through enhancing task psychometrics.
-
Optimization of conditions for in vitro modeling of subgingival normobiosis and dysbiosisModeling subgingival microbiome in health and disease is key to identifying the drivers of dysbiosis and to studying microbiome modulation. Here, we optimize growth conditions of our previously described in vitro subgingival microbiome model. Subgingival plaque samples from healthy and periodontitis subjects were used as inocula to grow normobiotic and dysbiotic microbiomes in MBEC assay plates. Saliva supplemented with 1%, 2%, 3.5%, or 5% (v/v) heat-inactivated human serum was used as a growth medium under shaking or non-shaking conditions. The microbiomes were harvested at 4, 7, 10 or 13 days of growth (384 microbiomes in total) and analyzed by 16S rRNA gene sequencing. Biomass significantly increased as a function of serum concentration and incubation period. Independent of growth conditions, the health- and periodontitis-derived microbiomes clustered separately with their respective inocula. Species richness/diversity slightly increased with time but was adversely affected by higher serum concentrations especially in the periodontitis-derived microbiomes. Microbial dysbiosis increased with time and serum concentration. Porphyromonas and Alloprevotella were substantially enriched in higher serum concentrations at the expense of Streptococcus, Fusobacterium and Prevotella. An increase in Porphyromonas, Bacteroides and Mogibacterium accompanied by a decrease in Prevotella, Catonella, and Gemella were the most prominent changes over time. Shaking had only minor effects. Overall, the health-derived microbiomes grown for 4 days in 1% serum, and periodontitis-derived microbiomes grown for 7 days in 3.5%–5% serum were the most similar to the respective inocula. In conclusion, normobiotic and dysbiostic subgingival microbiomes can be grown reproducibly in saliva supplemented with serum, but time and serum concentration need to be adjusted differently for the health and periodontitis-derived microbiomes to maximize similarity to in vivo inocula. The optimized model could be used to identify drivers of dysbiosis, and to evaluate interventions such as microbiome modulators.
-
Income Inequality in College Enrollment and Degree Attainment During and After the Great Recession YearsPrior research using the Current Population Surveys (CPS) documents a dramatic equalization in U.S. college enrollments based on family income starting in 2014. However, the measurement of income for independent young adults is problematic; we correct for this by imputing their incomes. We complement our reanalysis of CPS data with data from the Panel Study for Income Dynamics-Transition into Adulthood (PSID-TA). Both data sets show moderate, nonsignificant reductions in the income gap in college enrollments for cohorts coming of age during and after the Recession. Extending the CPS analysis to examine inequalities during the COVID pandemic, we show more or less unchanged inequalities for the cohort coming of age in 2020. Using the PSID-TA to examine degree attainment, we again find stable income inequalities in obtaining any degree and a bachelor’s degree for pre-Recession and Recession-era cohorts.
